Viromusic 1 (NFT songs made by the virus)

ViroMusic is an NFT collection of songs made using the code inside the Coronavirus. All the notes in the melody are a direct translation of the RNA code in the virus. The songs were made using a process called DNA Sonification, where every letter of the code is turned into a musical note. We wrote an algorithm which searches through the Coronavirus to find a continuous stretch of code that sounds musical, then we added human-played accompaniment on top of the viral melody (Cello, guitar, etc). The songs are available as part of a 10,000 song NFT collection on Rarible: Every one of the NFTs has a unique melody derived from the virus - no two songs are alike. 𝗠𝗼𝗿𝗲 𝗶𝗻𝗳𝗼: 𝗦𝗲𝗲 𝗼𝘂𝗿 𝗼𝘁𝗵𝗲𝗿 𝗩𝗶𝗿𝗼𝗠𝘂𝘀𝗶𝗰 𝘃𝗶𝗱𝗲𝗼𝘀: 𝗛𝗼𝘄 𝗩𝗶𝗿𝗼𝗠𝘂𝘀𝗶𝗰 𝗶𝘀 𝗺𝗮𝗱𝗲: 𝗗𝗼𝗻’𝘁 𝗳𝗼𝗿𝗴𝗲𝘁 𝘁𝗼 𝘀𝘂𝗯𝘀𝗰𝗿𝗶𝗯𝗲 𝘁𝗼 𝗼𝘂𝗿 𝗰𝗵𝗮𝗻𝗻𝗲𝗹: 𝗧𝗲𝗰𝗵𝗻𝗶𝗰𝗮𝗹 𝗱𝗲𝘁𝗮𝗶𝗹𝘀 𝗮𝗯𝗼𝘂𝘁 𝘁𝗵𝗲 𝘀𝗼𝗻𝗴: This song was made using RNA position 4989 thru 5580 (in the NSP3 gene) 𝗧𝗵𝗲 𝘃𝗶𝗿𝗮𝗹 𝗰𝗼𝗱𝗲 𝘂𝘀𝗲𝗱 𝗶𝗻 𝘁𝗵𝗶𝘀 𝘀𝗼𝗻𝗴: CAACATTAACCTCCACACGCAAGTTGTGGACATGTCAATGACATATGGACAACAGTTTGGTCCAACTTATTTGGATGGAGCTGATGTTACTAAAATAAAACCTCATAATTCACATGAAGGTAAAACATTTTATGTTTTACCTAATGATGACACTCTACGTGTTGAGGCTTTTGAGTACTACCACACAACTGATCCTAGTTTTCTGGGTAGGTACATGTCAGCATTAAATCACACTAAAAAGTGGAAATACCCACAAGTTAATGGTTTAACTTCTATTAAATGGGCAGATAACAACTGTTATCTTGCCACTGCATTGTTAACACTCCAACAAATAGAGTTGAAGTTTAATCCACCTGCTCTACAAGATGCTTATTACAGAGCAAGGGCTGGTGAAGCTGCTAACTTTTGTGCACTTATCTTAGCCTACTGTAATAAGACAGTAGGTGAGTTAGGTGATGTTAGAGAAACAATGAGTTACTTGTTTCAACATGCCAATTTAGATTCTTGCAAAAGAGTCTTGAACGTGGTGTGTAAAACTTGTGGACAACAGCAGACAACCCTTAAGGGTGTAGAAGCTGTTATGTACATGGG 𝗧𝗵𝗲 𝗺𝘂𝘀𝗶𝗰𝗮𝗹 𝗻𝗼𝘁𝗲 𝘁𝗼 𝗮𝗺𝗶𝗻𝗼 𝗮𝗰𝗶𝗱 𝗺𝗮𝗽𝗽𝗶𝗻𝗴 𝗶𝘀: Alanine = A3 Arginine = G4 Asparagine = D5 Aspartic Acid = A#3 Cysteine = A#6 Glutamine = D4 Glutamic Acid = A4 Glycine = D7 Histidine = A#5 Isoleucine = A#4 Leucine = G5 Lysine = F5 Methionine / Start codon = D5 Phenylalanine = F3 Proline = G3 Serine = G6 Stop Codon = A5 Threonine = A6 Tryptophan = F4 Tyrosine = F6 Valine = D6 𝗔𝗯𝗼𝘂𝘁 𝘁𝗵𝗲 𝗴𝗲𝗻𝗲 𝘂𝘀𝗲𝗱 𝘁𝗼 𝗺𝗮𝗸𝗲 𝘁𝗵𝗶𝘀 𝘀𝗼𝗻𝗴: NSP3: This gene helps the virus by interfering with a part of your immune system. The gene makes an enzyme called a protease, which breaks down specific proteins in your innate immune system.